Sequence ID | >WENV181545291 |
Genome ID | OGIG01026375 |
Search identical group | |
Phylum/Class | [OGIG] metagenome; Human gut stool |
Species | |
Start position on genome | 387 |
End posion on genome | 462 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tattttccac |
tRNA gene sequence |
GGGGTATTAGCTCAGTTGGTAGAGCGTCTCGTTCGCAATGAGAAGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
tccatctctc |
Secondary structure (Cloverleaf model) | >WENV181545291 Ala CGC c ACCA tccatctctc G - C G - C G + T G - C T - A A - T T - A T A T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C T A G AGGTC T - A C - G T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |