Sequence ID | >WENV181554017 |
Genome ID | OGIR01003522 |
Search identical group | |
Phylum/Class | [OGIR] metagenome; Human gut stool |
Species | |
Start position on genome | 586 |
End posion on genome | 511 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttaaccggtt |
tRNA gene sequence |
GGGTTGTTAGCTCAGTTGGTAGAGCAGCGGACTCTTAATCCGTCGGTCGAGAGTTCGAGT |
Downstream region at tRNA end position |
attacatttt |
Secondary structure (Cloverleaf model) | >WENV181554017 Lys CTT t ACCA attacatttt G - C G - C G - C T + G T - A G - C T - A T G T C T C T C A T G A A | | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A A CGGTC G + T C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |