Sequence ID | >WENV181555800 |
Genome ID | OGIU01000241 |
Search identical group | |
Phylum/Class | [OGIU] metagenome; Human gut stool |
Species | |
Start position on genome | 19199 |
End posion on genome | 19125 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tgaaagacaT |
tRNA gene sequence |
GCGCCACTAGCTCAGCTGGCAGAGCACCTGACTCTTAATCAGGGTGTCCAGGGTTCGAAC |
Downstream region at tRNA end position |
cagaagtatc |
Secondary structure (Cloverleaf model) | >WENV181555800 Lys CTT T ATta cagaagtatc G - C C - G G - C C - G C - G A - T C - G C A T G T C C C A C G A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C C A A GTGTC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |