Sequence ID | >WENV181567834 |
Genome ID | OGJK01000017 |
Search identical group | |
Phylum/Class | [OGJK] metagenome; Human gut stool |
Species | |
Start position on genome | 143929 |
End posion on genome | 143844 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttgaaaggat |
tRNA gene sequence |
GCTCGAATGGTGGAATCGGTAGACACGAGGGACTTAAAATCCCTTGGCCATTGCGGCTGT |
Downstream region at tRNA end position |
atgtatctta |
Secondary structure (Cloverleaf model) | >WENV181567834 Leu TAA t ACag atgtatctta G + T C - G T - A C - G G - C A - T A - T T G T C G C C C A T A A G | | | | | A C G G T G G C G G G C G | | | T T G A C A C T A G G TGGCCATTGCGGCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |