Sequence ID | >WENV181607899 |
Genome ID | OGLM01033970 |
Search identical group | |
Phylum/Class | [OGLM] metagenome; Human gut stool |
Species | |
Start position on genome | 754 |
End posion on genome | 826 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gatgtactat |
tRNA gene sequence |
GGTTCCGTGGTCTAGTGGTATGATACCTCCCTTACAAGGAGGGGATCACGAGTTCGAATC |
Downstream region at tRNA end position |
cttaactatt |
Secondary structure (Cloverleaf model) | >WENV181607899 Val TAC t ACtt cttaactatt G - C G - C T - A T - A C - G C - G G - C T A T T G C T C A G A G | | | | | G T T C T G A C G A G C G | | + T T G T G A T T A A GGATC C - G C - G T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |