Sequence ID | >WENV181618647 |
Genome ID | OGMC01003869 |
Search identical group | |
Phylum/Class | [OGMC] metagenome; Human gut stool |
Species | |
Start position on genome | 1473 |
End posion on genome | 1399 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
accacttaac |
tRNA gene sequence |
GGCAGGGTAGCTCAGTGGTAGAGCAGAGGACTCATAAGCCTTTGGTCGGGTGTTCAAATC |
Downstream region at tRNA end position |
tcttcaaagc |
Secondary structure (Cloverleaf model) | >WENV181618647 Met CAT c ACCA tcttcaaagc G + T G - C C - G A - T G - C G - C G - C T A T T C C A C A G A A + | | | | A T C T C G G G G T G C G | | | | T T G G A G C T A A TGGTC G + T A - T G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |