Sequence ID | >WENV181619519 |
Genome ID | OGME01000047 |
Search identical group | |
Phylum/Class | [OGME] metagenome; Human gut stool |
Species | |
Start position on genome | 117882 |
End posion on genome | 117811 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aattaaataa |
tRNA gene sequence |
GGCTCCATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCAAATC |
Downstream region at tRNA end position |
ttgttcttat |
Secondary structure (Cloverleaf model) | >WENV181619519 Glu TTC a Attt ttgttcttat G - C G + T C - G T - A C - G C - G A - T T A T T C C C C A C G A G | | | | | A G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |