Sequence ID | >WENV181632807 |
Genome ID | OGMU01000212 |
Search identical group | |
Phylum/Class | [OGMU] metagenome; Human gut stool |
Species | |
Start position on genome | 27995 |
End posion on genome | 28081 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aacagaatat |
tRNA gene sequence |
GCGGATATGGCGGAATTGGCAGACGCGTTAGATTCAGGTTCTAATCGGGGCAACTCGGTG |
Downstream region at tRNA end position |
aacaatgaaa |
Secondary structure (Cloverleaf model) | >WENV181632807 Leu CAG t ACCA aacaatgaaa G - C C - G G - C G - C A - T T - A A - T T G T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C C A G G TCGGGGCAACTCGGT T - A T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |