Sequence ID | >WENV181633392 |
Genome ID | OGMV01000624 |
Search identical group | |
Phylum/Class | [OGMV] metagenome; Human gut stool |
Species | |
Start position on genome | 5679 |
End posion on genome | 5749 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cccgacgcat |
tRNA gene sequence |
GCGGGTGTAGTTCAGTGGTAGAACACCAGCCTTCCAAGCTGGATATGTGGGTTCGATTCC |
Downstream region at tRNA end position |
cttgtgcaat |
Secondary structure (Cloverleaf model) | >WENV181633392 Gly TCC t Ttaa cttgtgcaat G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A G A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A A ATAT C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |