Sequence ID | >WENV181634901 |
Genome ID | OGMW01039263 |
Search identical group | |
Phylum/Class | [OGMW] metagenome; Human gut stool |
Species | |
Start position on genome | 56 |
End posion on genome | 132 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttcatgcct |
tRNA gene sequence |
GGCGGTGTAGCTCAGCTGGTTAGAGCGCACGACTCATAATCGTGAGGTCGACGGATCGAG |
Downstream region at tRNA end position |
acaacgaacc |
Secondary structure (Cloverleaf model) | >WENV181634901 Met CAT t ACCA acaacgaacc G + T G - C C - G G - C G - C T - A G - C C G T C T G C C A C G A A | | | | | G T C T C G G A C G G C G | | | | A T G G A G C T T A G AGGTC C - G A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |