Sequence ID | >WENV181635414 |
Genome ID | OGMX01003493 |
Search identical group | |
Phylum/Class | [OGMX] metagenome; Human gut stool |
Species | |
Start position on genome | 439 |
End posion on genome | 364 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
attgtgaccc |
tRNA gene sequence |
GATTCAGTAGCTCAGCCGGTAGAGCACAACACTTTTAATGTTGGGGTCCTGGGTTCGAAT |
Downstream region at tRNA end position |
aaagaaaagc |
Secondary structure (Cloverleaf model) | >WENV181635414 Lys TTT c ACCA aaagaaaagc G - C A - T T - A T + G C - G A - T G - C T A T G A C C C A C G A A | | | | | G C C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |