Sequence ID | >WENV181636216 |
Genome ID | OGMZ01001110 |
Search identical group | |
Phylum/Class | [OGMZ] metagenome; Human gut stool |
Species | |
Start position on genome | 5013 |
End posion on genome | 4930 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttctaaggtt |
tRNA gene sequence |
GGAAGGTTATCCTAATTGGTAAGGAACCGGTCTTGAAAACCGGCGCCGCAAGGCTTCAGA |
Downstream region at tRNA end position |
taaacggtga |
Secondary structure (Cloverleaf model) | >WENV181636216 Ser TGA t GCCA taaacggtga G - C G - C A - T A - T G - C G + T T - A T A T G T C T C A T A A A | | | | | G T T C C T C A G A G C G | | | | T T G A G G A T A A CGCCGCAAGGCTT C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |