Sequence ID | >WENV181637305 |
Genome ID | OGNB01003849 |
Search identical group | |
Phylum/Class | [OGNB] metagenome; Human gut stool |
Species | |
Start position on genome | 171 |
End posion on genome | 94 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tctcttgcaa |
tRNA gene sequence |
CGGGATGTGGCTCAGTTTGGCTAGAGCGCAGCGTTCGGGACGCTGAGGCCGCGCGTTCAA |
Downstream region at tRNA end position |
taaaaaacag |
Secondary structure (Cloverleaf model) | >WENV181637305 Pro CGG a ACCA taaaaaacag C - G G - C G - C G - C A - T T - A G - C T A T C G C G C A T T G A G | | | | | A T C T C G G C G C G C G | | | | T T G G A G C C T A G AGGCC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |