Sequence ID | >WENV181643038 |
Genome ID | OGNH01011941 |
Search identical group | |
Phylum/Class | [OGNH] metagenome; Human gut stool |
Species | |
Start position on genome | 620 |
End posion on genome | 549 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ctcacgacaa |
tRNA gene sequence |
TGCGCCATCGCCAAGCGGTAAGGCAGGGGACTTTGACTCCCCCATCGTAGGTTCGACTCC |
Downstream region at tRNA end position |
tataaaaaag |
Secondary structure (Cloverleaf model) | >WENV181643038 Gln TTG a ACtg tataaaaaag T - A G - C C - G G - C C - G C - G A - T T C T C G T C C A G A C | + | | | G C A C C G G T A G G C G | | | T T G A G G C T A A CATC G - C G - C G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |