Sequence ID | >WENV181649784 |
Genome ID | OGNT01000164 |
Search identical group | |
Phylum/Class | [OGNT] metagenome; Human gut stool |
Species | |
Start position on genome | 4866 |
End posion on genome | 4940 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aatatgtttT |
tRNA gene sequence |
GCGCGATTAGCTCAGTTGGCAGAGCACCTGACTCTTAATCAGGGTGTCCAGGGTTCGAAC |
Downstream region at tRNA end position |
ttatatttta |
Secondary structure (Cloverleaf model) | >WENV181649784 Lys CTT T ATtt ttatatttta G - C C - G G - C C - G G - C A - T T - A C A T G T C C C A T G A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C C A A GTGTC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |