Sequence ID | >WENV181665009 |
Genome ID | OGOJ01000052 |
Search identical group | |
Phylum/Class | [OGOJ] human gut metagenome; faeces |
Species | |
Start position on genome | 91640 |
End posion on genome | 91552 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tccgaaaaaa |
tRNA gene sequence |
GGAGAGGTGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACCCCAAAAGGGT |
Downstream region at tRNA end position |
aagtagaaaa |
Secondary structure (Cloverleaf model) | >WENV181665009 Ser GGA a GCaa aagtagaaaa G - C G - C A - T G - C A - T G - C G + T T A T G C C C C A T G A G | | | | | G G G C T C C G G G G C G | | | T T T A G A G T G A G TATACCCCAAAAGGGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |