Sequence ID | >W141165091 |
Genome ID | AXSN02000002 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Bordetella pertussis H918 [AXSN] |
Start position on genome | 77314 |
End posion on genome | 77388 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tccaagattt |
tRNA gene sequence |
GCCCATGTGGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCACGCGTTCGATCC |
Downstream region at tRNA end position |
tcgaattcta |
Secondary structure (Cloverleaf model) | >W141165091 Thr GGT t ACCA tcgaattcta G - C C - G C - G C - G A - T T - A G - C C T T T G C G C A G A G | | | | | G T C T C G A C G C G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |