Sequence ID | >WENV181675684 |
Genome ID | OGOP01009397 |
Search identical group | |
Phylum/Class | [OGOP] human gut metagenome; faeces |
Species | |
Start position on genome | 932 |
End posion on genome | 1007 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ggtcgccaat |
tRNA gene sequence |
GCCTCGGTAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCGCAGTTCGATT |
Downstream region at tRNA end position |
ttctttatgc |
Secondary structure (Cloverleaf model) | >WENV181675684 Phe GAA t ACCA ttctttatgc G - C C - G C - G T - A C - G G + T G - C T T T G C G T C A T G A A | | | | | G T C T C G C G C A G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |