Sequence ID | >WENV181691253 |
Genome ID | OGOZ01004056 |
Search identical group | |
Phylum/Class | [OGOZ] human gut metagenome; faeces |
Species | |
Start position on genome | 1621 |
End posion on genome | 1529 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cacaaatttT |
tRNA gene sequence |
GGAGAGGTGGCTGAGAGGCCGAAAGCGGCGGTTTGCTAAACCGTTATACGGGTTAATTCC |
Downstream region at tRNA end position |
tttagttttg |
Secondary structure (Cloverleaf model) | >WENV181691253 Ser GCT T GTat tttagttttg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A A G A G | | | | | G G G T C G G A G G G C G | | | T T C A A G C C G A G TATACGGGTTAATTCCCGTATC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |