Sequence ID | >WENV181699687 |
Genome ID | OGPG01000372 |
Search identical group | |
Phylum/Class | [OGPG] human gut metagenome; faeces |
Species | |
Start position on genome | 42817 |
End posion on genome | 42891 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
agccttagtc |
tRNA gene sequence |
AGTCTCTTAGCTCAGTTGGTTAGAGCGCTACACTGATAATGTAGAGGTCCGCGGTTCAAC |
Downstream region at tRNA end position |
aaaagcccga |
Secondary structure (Cloverleaf model) | >WENV181699687 Ile GAT c ACtc aaaagcccga A - T G - C T - A C - G T + G C - G T - A T C T G C G C C A T G A A | | | | | A T C T C G C G C G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |