Sequence ID | >WENV181703005 |
Genome ID | OGPJ01002044 |
Search identical group | |
Phylum/Class | [OGPJ] human gut metagenome; faeces |
Species | |
Start position on genome | 12932 |
End posion on genome | 12857 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttttttatct |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCAGCGGTCTCCAAAACCGCGTGCCGAGGGTTCGAAT |
Downstream region at tRNA end position |
tacttgtgca |
Secondary structure (Cloverleaf model) | >WENV181703005 Trp CCA t GCCA tacttgtgca A - T G - C G - C G - C G - C T + G A - T T A T C T T C C A T G A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C T A A GTGCC G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |