Sequence ID | >WENV181706758 |
Genome ID | OGPL01002214 |
Search identical group | |
Phylum/Class | [OGPL] human gut metagenome; faeces |
Species | |
Start position on genome | 1895 |
End posion on genome | 1809 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attcacacac |
tRNA gene sequence |
GGAGAGGTATCGAAGCGGTCATAACGAGGCGGTCTTGAAAACCGTTTGTCCGAAAGGGCG |
Downstream region at tRNA end position |
aaaactcagt |
Secondary structure (Cloverleaf model) | >WENV181706758 Ser TGA c GCtc aaaactcagt G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G C G A A | | | | | G G A G C T G T G G G C T | | | T T C A C G A A T A G TTGTCCGAAAGGGCGC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |