Sequence ID | >WENV181713453 |
Genome ID | OGPQ01025070 |
Search identical group | |
Phylum/Class | [OGPQ] human gut metagenome; faeces |
Species | |
Start position on genome | 1085 |
End posion on genome | 1000 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
nnnnagtttt |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGATTGCGGCGGTCTTGAAAACCGTTGTACTGAAAGGTACC |
Downstream region at tRNA end position |
gaaagaattg |
Secondary structure (Cloverleaf model) | >WENV181713453 Ser TGA t GCtg gaaagaattg G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A T G A G | + | | | G G G A C G C G G G G C G + | | | T T T T T G C C G A G TGTACTGAAAGGTACC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |