Sequence ID | >W141170401 |
Genome ID | AXXW01000005 |
Search identical group | |
Phylum/Class | Mycoplasmatota |
Species | [Acholeplasma] multilocale ATCC 49900 [AXXW] |
Start position on genome | 122301 |
End posion on genome | 122225 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tcttgttatt |
tRNA gene sequence |
CGGAATATAGCTCAGCTGGTTAGAGCACTCCGCTGATAACGGAGAGGTCGTTGGTTCAAG |
Downstream region at tRNA end position |
tttaaaaata |
Secondary structure (Cloverleaf model) | >W141170401 Ile GAT t ACCA tttaaaaata C - G G - C G - C A - T A - T T - A A - T T G T T A A C C A C G A A + | | | | A T C T C G G T T G G C G | | | | T T G G A G C T T A A AGGTC C - G T - A C - G C - G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |