Sequence ID | >WENV181728035 |
Genome ID | OGQA01013788 |
Search identical group | |
Phylum/Class | [OGQA] human gut metagenome; faeces |
Species | |
Start position on genome | 1222 |
End posion on genome | 1147 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gctgcatgtg |
tRNA gene sequence |
GCGGATGTAGCTCAGTTGGCAGAGCATCTGGTTGTGGCCCAGAGGGCCGTGGGTTCAAGT |
Downstream region at tRNA end position |
ctcacttgtc |
Secondary structure (Cloverleaf model) | >WENV181728035 His GTG g CCCA ctcacttgtc G - C C - G G - C G + T A - T T - A G - C T G T T A C C C A T G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C C A A GGGCC T - A C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |