Sequence ID | >WENV181728101 |
Genome ID | OGQA01017527 |
Search identical group | |
Phylum/Class | [OGQA] human gut metagenome; faeces |
Species | |
Start position on genome | 2333 |
End posion on genome | 2257 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tgccatattt |
tRNA gene sequence |
GCGCCAGTAGCTCAGTTGGATAGAGCAGCAGCCTTCTAAGCTGCGGGCCGTGGGTTCGAT |
Downstream region at tRNA end position |
atagatttca |
Secondary structure (Cloverleaf model) | >WENV181728101 Arg TCT t ACCA atagatttca G - C C - G G - C C - G C - G A - T G - C T T T C C T C C A T G A A | + | | G T C T C G G T G G G C G | | | | T T G G A G C A T A A GGGCC G - C C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |