Sequence ID | >W141171301 |
Genome ID | AXZR01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sulfitobacter pontiacus 3SOLIMAR09 [AXZR] |
Start position on genome | 125 |
End posion on genome | 198 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttgcggccga |
tRNA gene sequence |
GGCGAGTTGGCGGAGTGGTTACGCAGCGGATTGCAAATCCGTGTACAGGAGTTCGATTCT |
Downstream region at tRNA end position |
ttataattca |
Secondary structure (Cloverleaf model) | >W141171301 Cys GCA a TCCA ttataattca G - C G - C C - G G - C A - T G - C T - A T T T T C C T C A G A G | | | | | G T G G C G A G G A G C G | | | T T G A C G C T T A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |