Sequence ID | >WENV181734011 |
Genome ID | OGQF01000002 |
Search identical group | |
Phylum/Class | [OGQF] human gut metagenome; faeces |
Species | |
Start position on genome | 217843 |
End posion on genome | 217769 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
acagagagat |
tRNA gene sequence |
GTGTCTGTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tggtgggtat |
Secondary structure (Cloverleaf model) | >WENV181734011 Arg TCT t GCtg tggtgggtat G - C T - A G - C T + G C - G T - A G - C T A T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |