Sequence ID | >WENV181755712 |
Genome ID | OGQS01012310 |
Search identical group | |
Phylum/Class | [OGQS] human gut metagenome; faeces |
Species | |
Start position on genome | 886 |
End posion on genome | 960 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acaccgcatt |
tRNA gene sequence |
GCGGGAGTAACTCAGCGGTAGAGTGTCAGCTTCCCAAGCTGAAGGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ggaatctcaa |
Secondary structure (Cloverleaf model) | >WENV181755712 Gly CCC t TCCA ggaatctcaa G - C C - G G - C G - C G - C A - T G + T T A T T G C C C A G A A + | | | | A C C T C A G C G G G C G | | | | T T G G A G T T A G AGGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |