Sequence ID | >WENV181772442 |
Genome ID | OGRD01003637 |
Search identical group | |
Phylum/Class | [OGRD] human gut metagenome; faeces |
Species | |
Start position on genome | 4378 |
End posion on genome | 4451 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
attatccgct |
tRNA gene sequence |
GGGCAGGTAGATCAGTTGGAAGATCGCTACATTGGCATTGTAGAGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
atcttttgtc |
Secondary structure (Cloverleaf model) | >WENV181772442 Ala GGC t ACtc atcttttgtc G - C G - C G + T C - G A - T G - C G - C T A T C G C T C A T G A A | | | | | G T C T A G G C G A G C G | | | | T T G G A T C A A G AGGTC C - G T - A A - T C - G A - T T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |