Sequence ID | >WENV181785573 |
Genome ID | OGRM01053573 |
Search identical group | |
Phylum/Class | [OGRM] human gut metagenome; faeces |
Species | |
Start position on genome | 226 |
End posion on genome | 311 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aggcctccat |
tRNA gene sequence |
GCTCAGGTGGCGGAATTGGTAGACGCGCTAGACTAAGGATCTAGTGGTGATAAACCGTAG |
Downstream region at tRNA end position |
attgataaac |
Secondary structure (Cloverleaf model) | >WENV181785573 Leu AAG t ACCA attgataaac G - C C - G T - A C - G A C G - C G - C T G T T C C C C A T A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C T A G G TGGTGATAAACCGT C - G T - A A - T G - C A - T C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |