Sequence ID | >WENV181787276 |
Genome ID | OGRN01022050 |
Search identical group | |
Phylum/Class | [OGRN] human gut metagenome; faeces |
Species | |
Start position on genome | 369 |
End posion on genome | 443 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gcgcaccaat |
tRNA gene sequence |
GGCCCGTTGGTCAAGCGGCTAAGACGGCGGCCTCTCACGCCGCAAACGTGGGTTCGATTC |
Downstream region at tRNA end position |
tcatttttct |
Secondary structure (Cloverleaf model) | >WENV181787276 Glu CTC t ACCA tcatttttct G - C G + T C - G C - G C - G G - C T - A T T T C G C C C A C G A G | + | | | G G A C T G G T G G G C G | | | T T C A G A C T A G AAAC G - C C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |