Sequence ID | >WENV181789929 |
Genome ID | OGRO01061151 |
Search identical group | |
Phylum/Class | [OGRO] human gut metagenome; faeces |
Species | |
Start position on genome | 696 |
End posion on genome | 621 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taaaaaagat |
tRNA gene sequence |
GCCGAAATAGCTCAATTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGCGGGTTCAAGT |
Downstream region at tRNA end position |
tctggtgggg |
Secondary structure (Cloverleaf model) | >WENV181789929 Thr TGT t ACCA tctggtgggg G - C C - G C - G G - C A - T A - T A - T T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |