Sequence ID | >WENV181801918 |
Genome ID | OGSC01000348 |
Search identical group | |
Phylum/Class | [OGSC] human gut metagenome; fecal sample 8 from infant 5 |
Species | |
Start position on genome | 241 |
End posion on genome | 316 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gaggtaagat |
tRNA gene sequence |
GGCTCGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGGTTCGATT |
Downstream region at tRNA end position |
tatatggcgc |
Secondary structure (Cloverleaf model) | >WENV181801918 Phe GAA t ACCA tatatggcgc G - C G - C C - G T - A C - G G - C A - T T T T T G A C C A T G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |