Sequence ID | >WENV181804811 |
Genome ID | OGSG01000790 |
Search identical group | |
Phylum/Class | [OGSG] human gut metagenome; fecal sample 2 from infant 7 |
Species | |
Start position on genome | 2421 |
End posion on genome | 2495 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tcactgcctc |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGCTAGCGCACTTCGTTCACACCGAAGGGGTCGTAGGTTCGATT |
Downstream region at tRNA end position |
gagattcgcg |
Secondary structure (Cloverleaf model) | >WENV181804811 Val CAC c ACCt gagattcgcg G - C G - C G - C C - G G - C A - T T - A T T T C A T C C A C G A G | | | | | G G C G C G G T A G G C G | | | | T T C G C G C T A A GGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |