Sequence ID | >WENV181804831 |
Genome ID | OGSG01001420 |
Search identical group | |
Phylum/Class | [OGSG] human gut metagenome; fecal sample 2 from infant 7 |
Species | |
Start position on genome | 883 |
End posion on genome | 808 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ggagttgctc |
tRNA gene sequence |
GGGTTTGTAGCTCAGTGGATAGAGCGTCTGTCTCCGGAACAGAAGGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
gtggggcttt |
Secondary structure (Cloverleaf model) | >WENV181804831 Arg CCG c ACCA gtggggcttt G - C G - C G - C T + G T - A T - A G - C C T T T A C C C A T G A A + | | | | G G C T C G G T G G G C G | | | | T T A G A G C T A G AGGTC T - A C - G T - A G - C T - A C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |