Sequence ID | >WENV181807702 |
Genome ID | OGSQ01000042 |
Search identical group | |
Phylum/Class | [OGSQ] human gut metagenome; fecal sample 7 from infant 4 |
Species | |
Start position on genome | 82778 |
End posion on genome | 82853 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctgccaacat |
tRNA gene sequence |
GACTCACTAGCTCAGTTGGCAGAGCACCTGACTTTTAATCAGGGTGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
aattaaaact |
Secondary structure (Cloverleaf model) | >WENV181807702 Lys TTT t ACCA aattaaaact G - C A - T C - G T - A C - G A - T C - G T G T G G C G C A T G A A | | | | | G T C T C G C C G C G C G | | | | T T G G A G C C A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |