Sequence ID | >WENV181811381 |
Genome ID | OGSY01001222 |
Search identical group | |
Phylum/Class | [OGSY] human gut metagenome; fecal sample 5 from infant 8 |
Species | |
Start position on genome | 106 |
End posion on genome | 180 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tcaataatgt |
tRNA gene sequence |
TCCGCGATAGCTCAATGGTGGAGCACTCGGCTGTTAACCGATAGGTTGGAGGTTCGAGTC |
Downstream region at tRNA end position |
ttttttttat |
Secondary structure (Cloverleaf model) | >WENV181811381 Asn GTT t GCCA ttttttttat T - A C - G C - G G - C C - G G - C A - T T G T T C T C C A A A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C T G A AGGTT C T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |