Sequence ID | >WENV181814059 |
Genome ID | OGTE01003417 |
Search identical group | |
Phylum/Class | [OGTE] human gut metagenome; fecal sample 2 from infant 3 |
Species | |
Start position on genome | 138 |
End posion on genome | 212 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caccccatat |
tRNA gene sequence |
TGGGATGTCGCCAAGCGGTAAGGCAATGGACTTTGACTCCATTATGCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tttatttaat |
Secondary structure (Cloverleaf model) | >WENV181814059 Gln TTG t GCCA tttatttaat T - A G - C G - C G - C A - T T - A G - C T A T C G T C C A G A C | + | | | G C A C C G G T A G G C G | | | T T G A G G C T A A TATGC A - T T - A G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |