Sequence ID | >WENV181820386 |
Genome ID | OGUC01022831 |
Search identical group | |
Phylum/Class | [OGUC] metagenome; Human gut stool |
Species | |
Start position on genome | 275 |
End posion on genome | 349 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gtctcgcatg |
tRNA gene sequence |
GTGGGTATAGCGCAGTTGGTTAGCGCGCCAGATTGTGGCTCTGGAGGCCAAGGGTTCGAA |
Downstream region at tRNA end position |
tttcattagt |
Secondary structure (Cloverleaf model) | >WENV181820386 His GTG g CCtt tttcattagt G - C T - A G - C G - C G + T T - A A - T T A T T T C C C A T G A A | | | | | G T C G C G A A G G G C G | | | | T T G G C G C T T A G AGGCC C - G C - G A - T G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |