Sequence ID | >WENV181823922 |
Genome ID | OGUJ01030803 |
Search identical group | |
Phylum/Class | [OGUJ] metagenome; Human gut stool |
Species | |
Start position on genome | 651 |
End posion on genome | 575 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cgaaccttac |
tRNA gene sequence |
GGGCCCATAGCTCAGCTGGCTAGAGCGCACGACTGATAATCGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
ctaaaaagct |
Secondary structure (Cloverleaf model) | >WENV181823922 Ile GAT c ACCA ctaaaaagct G - C G - C G - C C - G C - G C - G A - T T G T T C A C C A C G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C C T A G AGGTC C - G A - T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |