| Sequence ID | >W08002198 |
| Genome ID | ABEQ01000019 |
| Phylum/Class | Bacillota |
| Species | Candidatus Epulopiscium viviparus 'N.t. morphotype B' [ABEQ] |
| Start position on genome | 1355 |
| End posion on genome | 1428 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
gagttaatac |
| tRNA gene sequence |
AGGGGTATAGTTCAGTTGGTAGAACGTCGGTCTCCAAAACCGGATGTCGTGGGTTCAAGT |
| Downstream region at tRNA end position |
atayggctga |
| Secondary structure (Cloverleaf model) | >W08002198 Trp CCA
c GCtt atayggctga
A - T
G - C
G - C
G - C
G - C
T + G
A - T T G
T C A T C C A
T G A A | | + | | A
T C T T G G T G G G C
G | | | | T T
G G A A C
T A G ATGTC
T + G
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |