Sequence ID | >WENV181833581 |
Genome ID | OGUQ01004009 |
Search identical group | |
Phylum/Class | [OGUQ] metagenome; Human gut stool |
Species | |
Start position on genome | 263 |
End posion on genome | 190 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tagcatgaat |
tRNA gene sequence |
GACTTGGTAGCTCAGTTGGTAGAGCAAATGACTCTTAATCATTGGGTCGAGGGTTCGAGC |
Downstream region at tRNA end position |
gctaaaaggc |
Secondary structure (Cloverleaf model) | >WENV181833581 Lys CTT t ACaa gctaaaaggc G - C A - T C - G T + G T - A G - C G - C C G T C T C C C A T G A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |