Sequence ID | >W08005773 |
Genome ID | ABIE01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Phaeobacter inhibens 2.1 [ABIE] |
Start position on genome | 36879 |
End posion on genome | 36954 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gccgcaccgt |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCGACGGTCTCCAAAACCGTAGGTCTCGGGTTCGAAC |
Downstream region at tRNA end position |
ctctctcatc |
Secondary structure (Cloverleaf model) | >W08005773 Trp CCA t GCCA ctctctcatc A - T G - C G - C G - C G - C T + G A - T C A T A G T C C A T G A A | | + | | G T C T C G T C G G G C G | | | | T T G G A G C T A G AGGTC A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |