Sequence ID | >WENV181852809 |
Genome ID | OGWH01004003 |
Search identical group | |
Phylum/Class | [OGWH] freshwater metagenome; freshwater |
Species | |
Start position on genome | 1643 |
End posion on genome | 1570 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cttaatctca |
tRNA gene sequence |
CGGGATGTGGCGCAGCTTGGTAGCGCACTTCGTTCGGGACGAAGGGGCCGCTGGTTCGAA |
Downstream region at tRNA end position |
tgggctgtta |
Secondary structure (Cloverleaf model) | >WENV181852809 Pro CGG a Attg tgggctgtta C - G G - C G - C G - C A - T T - A G - C T A T T G A C C A C G A G + | | | | G T C G C G G C T G G C T | | | | T T G G C G C G T A A GGGCC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |