Sequence ID | >WENV181854667 |
Genome ID | OGWK01010755 |
Search identical group | |
Phylum/Class | [OGWK] freshwater metagenome; freshwater |
Species | |
Start position on genome | 288 |
End posion on genome | 215 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccggaatcat |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCGATAGCCTTCCAAGCTATAGGTCGCGGGTTCGAGC |
Downstream region at tRNA end position |
caccgccggg |
Secondary structure (Cloverleaf model) | >WENV181854667 Gly TCC t TCag caccgccggg G - C C - G G - C G - C G - C A - T G - C C G T T G C T C A T G A A + | | + | G T C T C G G C G G G C G | | | | T T G G A G C T A G AGGTC A - T T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |