| Sequence ID | >WENV181855525 |
| Genome ID | OGWL01029514 |
| Phylum/Class | [OGWL] freshwater metagenome; freshwater |
| Species | |
| Start position on genome | 270 |
| End posion on genome | 199 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
tggagcttgt |
| tRNA gene sequence |
TGGGAGGTCGTCTAATGGCAAGACTGCGGACTCTGGATCCGCCTATCGGGGTTCGACTCC |
| Downstream region at tRNA end position |
cctacataaa |
| Secondary structure (Cloverleaf model) | >WENV181855525 Gln CTG
t GCtc cctacataaa
T - A
G - C
G - C
G - C
A - T
G - C
G - C T C
T G T C C C A
A A C | + | | | G
T T C T G C G G G G C
G | | | | T T
G A G A C
C A T CTAT
G - C
C - G
G - C
G - C
A - T
C A
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |