Sequence ID | >WENV181865660 |
Genome ID | OGWU01061992 |
Search identical group | |
Phylum/Class | [OGWU] human gut metagenome; faeces |
Species | |
Start position on genome | 221 |
End posion on genome | 308 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gcgggttcaa |
tRNA gene sequence |
GGAAGTTTGGGTGAGTGGCTGAAACCACCAGTTTGCTAAACTGACGTACTCGCAAGGGTA |
Downstream region at tRNA end position |
cgaaggctgc |
Secondary structure (Cloverleaf model) | >WENV181865660 Ser GCT a GCaa cgaaggctgc G - C G - C A - T A - T G - C T + G T C T A T C C C C C A T G A G | | | | | G G G T G G G G G G G C G | | | T T C A A C C T G A A CGTACTCGCAAGGGTACC C A C - G A - T G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |