Sequence ID | >WENV181880687 |
Genome ID | OGXG01004722 |
Search identical group | |
Phylum/Class | [OGXG] human gut metagenome; faeces |
Species | |
Start position on genome | 4817 |
End posion on genome | 4743 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaaaatgttt |
tRNA gene sequence |
GGTGCGTTAGTTCAGTTGGTTAGAATGCCTGCCTGTCACGCAGGAGGTCACGAGTTCGAG |
Downstream region at tRNA end position |
aaaccttcga |
Secondary structure (Cloverleaf model) | >WENV181880687 Asp GTC t GCag aaaccttcga G - C G - C T - A G - C C - G G - C T - A T G T T G C T C A T G A A | | | | | G T C T T G A C G A G C G | | | + T T G G A A T T T A G AGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |