Sequence ID | >WENV181894222 |
Genome ID | OGXQ01042782 |
Search identical group | |
Phylum/Class | [OGXQ] human gut metagenome; faeces |
Species | |
Start position on genome | 580 |
End posion on genome | 505 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tctccctgcg |
tRNA gene sequence |
GCGGAAGTAGCTCAGTTGGTAGAGCACCTGGTTGTGGCCCAGGTGGCCGTGGGTTCAAGT |
Downstream region at tRNA end position |
tacatttgcc |
Secondary structure (Cloverleaf model) | >WENV181894222 His GTG g CCCA tacatttgcc G - C C - G G - C G + T A - T A - T G - C T G T T A C C C A T G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T A A TGGCC C - G C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |